circad | circRNAs associated with diseases

mmu_circRNA_014961
Gene	ZMIZ1	Organism	Mouse
Genome Locus	n/a	Build	n/a
Disease	Myocardial infarction induced heart failure	ICD-10	Cardiovascular disease, unspecified (I51.6)
DBLink	Link to database	PMID	27336675
Experimental Method
Sample Type	Heart Ventricles	Comparison	Ten mice each group were euthanized and 20 mg left ventricular tissues was collected and stored in liquid nitrogen
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGGACCTGGGCTACAGACTCTT Reverse CTCCTGCCAGTCGATCACAAC	Statistics	Fold Change : Downregulated,2.401 pvalue : p=0.022
Citation
Wu, HJ, Zhang, CY, Zhang, S, Chang, M, Wang, HY (2016). Microarray Expression Profile of Circular RNAs in Heart Tissue of Mice with Myocardial Infarction-Induced Heart Failure. Cell. Physiol. Biochem., 39, 1:205-16.